Journal of Diabetes & Metabolism

ISSN - 2155-6156

+441518081309

Research Article - (2013) Volume 4, Issue 5

Analysis of Aldosterone Synthase Gene Promoter (- 344 C >T) Polymorphism in Indian Diabetic Nephropathy Patients

Pulakes Purkait1, Raychodhury P2, Bandhyopadhya S3, Naidu JM4 and Sarkar BN5*
1Anthropological Survey of India, WRC, Rajasthan, India
2Calcutta Medical College and Hospital, Kolkata, India
3BP Poddar Hospital and Research LTD, Kolkata, India
4VNR Vignana Jyothi Institute of Engineering and Technology, Andhra Pradesh, India
5Anthropological Survey of India, Kolkata, India
*Corresponding Author: Sarkar BN, Anthropological Survey of India, 27 Jawaharlal Nehru Road, Kolkata-700016, India Email:

Abstract

Aim: the aim of the present study is to evaluate the association between CYP11B2gene and type 2 diabetic nephropathy patients in Indian population.

Result: There was a significant difference in age, cholesterol, triglycerides, HDL, creatinine, BUN, Uric acid, total protein, Albumin, SBP, DBP variables except LDL Cholesterol among the study groups. The frequencies of CYP11B2 gene CC, CT, TT genotypes among the T2DNH are 16.67 %, 51.19 %, 32.14 %; in T2DM patient 10.66 %, 52.46 %, 36.88 % and 16.95%, 38.14%, 44.91% in controls respectively and we could not observe significant differences in both genotype (x2=7.289, p=0.121) and allele frequency (X2=1.82, p=0.403) of the CYP11B2 gene (-344 T>C) polymorphism between T2DNH, T2DM patients and Controls subjects.

Conclusion: Our findings do not support the hypothesis that CYP11B2 polymorphism is associated with prevalence of Type 2 diabetic nephropathy patients in Indian populations.

Introduction

Nephropathy is a chronic micro vascular complication of diabetes. Uncontrolled blood sugar level and high blood pressure are risk factor for the development of nephropathy or End Stage Renal Disease (ESRD) [1-4]. The Renin-Angiotensin-Aldosterone System (RAAS) is a regulator of both blood pressure and kidney functions and is suggested to play an important role in the development of nephropathy in Type 2 Diabetes Mellitus and genes encoding components of the RAAS can be candidate genes for evaluating predisposition for the development of hypertension, cardiovascular disease, ESRD or progression of renal disease in type 2 diabetes [5-12]. Aldosterone is an important component of RAAS, and plays an important role in controlling blood pressure, water and electrolyte homeostasis in the body [13]. Aldosterone is synthesized from deoxycorticosterone by a mitochondrial cytochrome P450 enzyme, aldosterone synthase (CYP11B2) [14] catalyze the final steps of the glucocorticoid and aldosterone biosynthesis pathways [15]. The CYP11B2 gene encodes a steroid 11/18-beta-hydroxylase that functions in mitochondria in the zonaglomerulosa of the adrenal cortex to synthesize the mineralocorticoid aldosterone and its expression is regulated by angiotensin II and potassium [16]. The CYP11B2 gene located on chromosome 8q22 [17-19] and contains 9 exons and 8 introns [20].

The -344 (C>T; rs1799998) variant is a commonly reported polymorphism of the CYP11B2 gene, which is located at a putative binding site for the steroidogenic transcription factor (SF-1) of the promoter region and involves a cytosine to thymidine substitution [21]. The -344 (C>T) polymorphism is associated with serum aldosterone level and production [22-24], blood pressure [19,25-27], left ventricular size and mass [18,28], Ischaemic Strok [7]. Its association was reported with progression of renal function [29-31] and ESRD [6]. However, there were few studies from India have been found on the association of CYP11B2 -344C/T polymorphism and CRI [5], T2DM [9] healthy volunteers [32]; hypertension [33,34], high-altitude adaptation [35].

Therefore, the aim of this study is to evaluate the relation between CYP11B2 polymorphism and Type 2 Diabetic Nephropathy on Hemodialysis patients in Indian population and the genotype and allele frequency of CYP11B2 gene (-344 C>T) promoter polymorphism.

Materials and Methods

This is a cross-sectional case control study. Ethical committee clearance was obtained from the respective medical institutions prior to the recruitment of subjects in this study. An informed consent was obtained from all the participants prior to their recruitment for the study.

Subjects

The study participant were 84 type 2 diabetic nephropathy on hemodialysis (T2DNH), 122 type 2 diabetes patients without nephropathy (T2DM) and 118 healthy controls (H.CON). The detection of Type 2 diabetic and nephropathy patients was based on physician’s recommendation, registered patient for dialysis and a detailed medical history of each patient was recorded accordingly. The healthy unrelated controls were randomly selected and recruited from local community centers. Subjects for the study were recruited at the participating medical institutions namely Calcutta Medical College (Kolkata), B.P. Poddar Hospital and research Centre (Kolkata).

Biochemical analysis

10 ml venous blood was collected from each individual included in the study for biochemical (5 ml) and genetic analysis (5 ml). Biochemical analyses to determine Total Cholesterol (mg/dl), Triglyceride (mg/dl), HDL Cholesterol (mg/dl), LDL Cholesterol (mg/dl), Creatinine (mg/ dl), BUN (mg/dl), Uric Acid (mg/dl), Total Protein (g/dl), Albumin (g/dl), Chloride by using automated analyzer (EM 360, TRANSASIA).

Molecular analysis of the aldosterone synthase (CYP11B2) gene

Approximately 5 ml of venous blood was drawn from each of the subjects in EDTA vials and genomic DNA was extracted from whole fresh blood using standard salting out method using phenol-chloroform [36]. The CYP11B2 (-344 C>T) polymorphism was identified by PCRRFLP method. Subjects were genotyped for the (-344 C>T) promoter polymorphism using primers CAGGAGGAGACCCCATGTGA (sense) and CCTCCACCCTGTTCAGCCC (antisense). Standard PCR amplification was performed in a final volume of 10 μL reaction mixture containing 50 ng of genomic DNA, 20 pmol of each primer, 10X Taq PCR buffer, 25 mM MgCl2, 100 mM of each dNTPs and 0.5 U/uL of Red Taq polymerase. PCR amplification was performed in a DNA thermo cycler (Gene Amp PCR 9700 - Applied Biosystems, USA). PCR was carried out with a Gradient standardize PCR condition with an initial denaturing time at 95°C for 5 min. Then the DNA was amplified for 35 cycles with denaturation at 94°C for 1 min, annealing at 69°C for 1:30 min and extension at 72°C for 1:30 min and final extension 72°C for 10 min. The PCR products were checked by 1% agarose gel electrophoresis with ethidium bromide staining and directly visualized in UV light.

Restriction fragment length polymorphism analysis (RFLP) was performed by adding 5 U of restriction endonuclease HaeIII (Fermentas) in the appropriate buffer to 4.5 uL of amplified 541 bp PCR product and by incubating at 37°C for 3 h and 30 min. Electrophoresis of the digested samples were done in 2.5% agarose gel with ethidium bromide stained, and analyzed under UV light. The C alleles are detected as fragments of 202 bp and the T alleles as fragments of 273 bp plus smaller fragments (138 bp, 125 bp, and 71 bp) in each case (Figure 1).

diabetes-metabolism-electrophoresis-stained

Figure 1: Agarose gel electrophoresis stained with ethidium bromide, showing the PCR- RFLP digestion for CYP11B2 (-344 T > C) polymorphism.

Statistical analysis

Data were analyzed using statistical package for Social Sciences statistical software (SPSS Version 16, Chicago, Illinois, USA). Data were expressed as mean and SD (continuous variables) or percentage. Statistical differences between groups were assessed by analysis of variance (ANOVA) or t test. Genotypes and allele frequencies of CYP11B2 gene polymorphism were compared between type 2 diabetic patients (T2DM), type 2 diabetic nephropathy on hemodialysis patients (T2DNH) and healthy match controls using χ2-test (MINITAB 11). Allele frequencies were calculated for the SNP and tested for Hardy- Weinberg equilibrium and allelic association with disease (exact tests, model tests) using PLINK (http://pngu.mgh.harvard.edu/~purcell/plink/). For comparing the allelic distributions between study groups the odds ratio (OR) with 95% confidence interval (CI) were also calculated. A level of p<0.05 was assumed statistical significance.

Results and Discussion

In this cross sectional case control study, 84 T2DNH subjects were compared with 122 T2DM subjects and 118 healthy control subjects. For the control subjects consisted of 61.9 % male and 38.1% female and the T2DNH and T2DM cases 53.6%, 52.5% male subject and 46.4%, 47.5% female respectively. Mean age for the case samples was higher than control samples.

Clinical characteristics of all subjects

The descriptive, ANOVA and Post Hoc tests had been done in order to find the means, SD, mean differences and significant difference of the base line clinical characteristics. Distribution of base line Clinical characteristics of the CONTROL, T2DM, and T2DNH are shown in Table 1 and mean differences of multiple Comparisons are shown in Table 2. There was a significant difference in all (age, cholesterol, triglycerides, HDL, creatinine, BUN, Uric acid, total protein, Albumin, SBP, DBP) variables except LDL Cholesterol among the study groups. In the analysis of multiple comparisons for mean difference of different groups shows a different picture. Further, we compare between Control and T2DM, T2DNH and T2DM and T2DNH. Age, cholesterol, triglycerides, HDL, BUN, Uric acid, total protein, Albumin, SBP were significant while LDL, creatinine and DBP were not significant when compared between control and T2DM. Age, HDL, creatinine, BUN, Uric acid, total protein, Albumin, SBP, DBP were significant while cholesterol, triglycerides, LDL were not significant when compared between control and T2DNH. Creatinine, BUN, total protein, albumin, SBP was significant while age, cholesterol, triglycerides, HDL, LDL, Uric acid and DBP were not significant when compared between T2DM and T2DNH. Among the T2DNH case, the significant difference of SBP showed that increase in SBP was likely to develop T2DNH and supports the findings of [8,31,37] as they were all reported that the association of (-344 C>T) polymorphism and hypertensive renal failure population. Table 3 shows the comparison of baseline clinical and biochemical characteristics of T2DNH opatients according to genotype of CYP11B2 gene promoter polymorphism. We could not observed significant different between three genotypes.

Variables Control (n = 118) T2DM ( n = 122) T2DMH ( n = 84) F p
Mean ± SD Mean  ± SD Mean  ± SD
Age (years) 48.16 ± 7.29 54.90 ± 11.29 53.98 ± 8.91 17.516 0.000*
Cholesterol (mg/dl) 159.71 ± 35.87 179.90 ± 42.10 164.09 ± 50.58 7.396 0.001*
Triglycerides (mg/dl) 151.38 ± 74.09 183.09 ± 88.64 155.81 ± 68.27 5.579 0.004*
HDL  Cholesterol (mg/dl) 41.45 ± 15.00 50.75 ± 17.39 50.45 ± 16.20 11.99 0.000*
LDL  Cholesterol (mg/dl) 96.10 ± 23.56 97.41 ± 30.28 94.80 ± 31.15 0.216 0.806
Creatinine (mg/dl) 0.97 ± 0.14 1.25 ± 0.51 1.72 ± 1.81 14.623 0.000*
Bun (mg/dl) 7.74 ± 2.68 13.30 ± 6.65 27.45 ± 18.69 89.365 0.000*
Uric acid (mg/dl) 5.72 ± 1.39 5.80 ± 1.20 6.32 ± 1.62 5.151 0.006*
Total protein (g/dl) 6.99 ± 0.51 8.08 ± 1.07 7.61 ± 1.16 41.487 0.000*
Albumin (g/dl) 3.87 ± 0.23 4.40 ± 0.55 4.12 ± 0.95 22.765 0.000*
Systolic blood pressure (mmHg) 123.57 ± 21.00 137.19 ± 20.11 151.49 ± 25.95 39.557 0.000*
Diastolic blood  ressure (mmHg) 82.89 ± 10.68 85.02 ± 10.11 88.08 ± 13.76 5.128 0.006*
*Significant at the P<0.05 level

Table 1: Distribution of Clinical and Biochemical characteristics of Healthy Control, T2DM and T2DNH patients.

Variables Group (I) Group (J) Mean Difference (I-J) p
Age
(years)
Control T2DM 6.7406 0.000*
T2DNH 5.8152 0.000*
T2DM T2DNH 0.9254 0.785
Cholesterol
(mg/dl)
Control T2DM 20.1903 0.001*
T2DNH 4.3791 0.770
T2DM T2DNH 15.8112 0.033*
Triglycerides (mg/dl) Control T2DM 31.7099 0.008*
T2DNH 4.4299 0.925
T2DM T2DNH 27.2800 0.051
HDL  Cholesterol (mg/dl) Control T2DM 9.3038 0.000*
T2DNH 9.0020 0.001*
T2DM T2DNH 0.3018 0.991
LDL  Cholesterol (mg/dl) Control T2DM 1.3159 0.937
T2DNH 1.2974 0.950
T2DM T2DNH 2.6133 0.809
Creatinine
(mg/dl)
Control T2DM 0.2742 0.095
T2DNH 0.7507 0.000*
T2DM T2DNH 0.4765 0.003*
Bun
(mg/dl)
Control T2DM 5.5620 0.000*
T2DNH 19.7090 0.000*
T2DM T2DNH 14.1470 0.000*
Uric acid
(mg/dl)
Control T2DM 0.0883 0.886
T2DNH 0.6033 0.010*
T2DM T2DNH 0.5150 0.034
Total protein
(g/dl)
Control T2DM 1.0970 0.000*
T2DNH 0.6177 0.000*
T2DM T2DNH 0.4792 0.002*
Albumin
(g/dl)
Control T2DM 0.5270 0.000*
T2DNH 0.2471 0.018*
T2DM T2DNH 0.2799 0.005*
Systolic blood pressure (mmHg) Control T2DM 13.6207 0.000*
T2DNH 27.9203 0.000*
T2DM T2DNH 14.2996 0.000*
Diastolic blood pressure (mmHg) Control T2DM 2.1348 0.348
T2DNH 5.1935 0.006*
T2DM T2DNH 3.0587 0.166
*The mean difference is significant at the 0.05 level

Table 2: Multiple Comparisons for Mean difference of different groups.

Variables CC (N=14) CT (N=43) TT(N=27) F p
Mean ± SD Mean ± SD Mean ± SD
Age (years) 57.14 ± 9.6 54.67 ± 10.11 51.22 ± 5.34 2.38 0.099
Cholesterol (mg/dl) 166.85  ± 46.29 162.42± 50.04 165.32 ± 55.15 0.051 0.950
Triglycerides (mg/dl) 164.05 ± 66.91 143.95± 59.04 170.43 ± 80.74 1.382 0.257
HDL CholesteroL (mg/dl) 45.94 ± 16.59 52.35 ± 15.79 49.76 ± 16.73 0.861 0.423
LDL CholesteroL (mg/dl) 93.11± 27.12 94.18 ± 29.24 96.67 ± 36.66 0.076 0.927
Creatinine (mg/dl) 1.44 ± 1.37 1.47 ± 1.38 2.27 ± 2.44 1.862 0.162
Bun (mg/dl) 25.9 ± 17 25.79 ± 18.09 30.87 ± 20.59 0.662 0.519
Uric acid (mg/dl) 7.13 ± 1.26 6.13 ± 1.49 6.2 ± 1.9 2.174 0.120
Total protein (g/dl) 7.94 ± 1.27 7.7 ± 1.15 7.285 ± 1.1 1.774 0.176
Albumin (g/dl) 4.19 ± 0.99 4.19 ± 0.88 3.97 ± 1.04 0.474 0.624
Systolic blood pressure (mmHg) 153.14 ± 20.87 148.7 ± 28.52 155.07 ± 24.29 0.529 0.591
Diastolic blood  pressure (mmHg) 92 ± 15.18 87.86 ± 14.37 86.41 ± 12.02 0.769 0.467

Table 3: Comparison of clinical and Biochemical characteristics of type 2 diabetic nephropathy on dialysis Patients according to CYP11B2 gene polymorphism.

In this study, older age can be said to be more susceptible to get T2DM and T2DNH as the means and standard deviation of T2DM and T2DNH case samples showed higher value (54.90 ± 11.28 and 53.97 ± 8.91) than control (48.16 ± 7.28).

Genotypic and allele frequency

Our study was designed to test the hypothesis that the prevalence of type 2 diabetic nephropathy may be influenced by the aldosterone synthase (CYP11B2) gene polymorphism of the RAAS. Figure 1 shows the PCR-RFLP digestion product size in agarose gel electrophoresis stained with ethidium bromide of CYP11B2 gene (-344 T>C) polymorphism. Genotype and allele frequencies for the polymorphism of CYP11B2 in T2DNH, T2DM and Healthy controls are presented in Table 4. The frequencies of CYP11B2 gene CC, CT, TT genotypes among the T2DNH are 16.67 %, 51.19 %, 32.14 %; in T2DM patient 10.66 %, 52.46 %, 36.88 % and 16.95%, 38.14%, 44.91% in controls respectively. In our study, we could not observe significant differences in both genotype (x2=7.289, p=0.121) and allele frequency (X2=1.82, p=0.403) of the CYP11B2 gene (-344 T>C) polymorphism between T2DNH, T2DM patients and Controls subjects. The CT genotype was the highest percentage among T2DNH and T2DM subject (51.19%, 52.46 % respectively) than the control subjects (38.14%). The CC genotype was almost same percentage among the T2DNH and Control subject (16.67%, 16.95% respectively) and the TT genotype was the highest among the control (44.91%). From the Table 5 it is evident that no significant association was observed for all the study groups with affected and non-affected MAF through Plink association test. From the analysis of HWE, it was found that the SNP (C -344 T) was in Hardy – Weinberg equilibrium. The association was further verified through 3 model – additive, dominant and recessive models to confirm which of these 3 models best predict the association at micro level. On the whole it was observed that dominant model more predictable that additive and recessive model, but there are no significant association in these 3 models.

Group Studied Genotypes Allele frequencies
  CC CT TT C T
Control
(N = 118)
20
(16.95)
45
(38.14)
53
(44.91)
85
(36.02)
151
(63.98)
T2DM
(N = 122)
13
(10.66)
64
(52.46)
45
(36.88)
90
(36.88)
154
(63.12)
T2DNH
(N = 84)
14
(16.67)
43
(51.19)
27
(32.14)
71
(42.26)
97
(57.74)
  X2 = 7.289 , P= 0.121 X2 = 1.82 , P= 0.403

Table 4: Genotype and Allele Frequencies of the CYP11B2 (-344 C >T) Polymorphism in Controls, T2DM andT2DNH Patients

Study Group MAF General Association HWE p Binary logistic regression
Group MAF X2 p OR (95 % CI) Additive Dominant Recessive
p OR (95 % CI) p OR (95 % CI) p OR (95 % CI)
Total study Samples 0.379 Aff 0.39 0.597 0.439 1.139 (0.818 - 1.587) 0.241 0.44 1.14 0.08 1.51 0.35 0.73
U Aff 0.36 0.072 0.82 - 1.59 0.96 - 2.41 0.39 - 1.39
T2DM & CON 0.379 Aff 0.37 0.039 0.843 1.038 (0.716 - 1.506) 0.823 0.85 1.04 0.21 1.39 0.16 0.58
U Aff 0.36 0.072 0.72 -1.49 0.83 - 2.34 0.27 -1.24
T2DNH & CON 0.386 Aff 0.42 1.615 0.204 1.3 (0.87 - 1.95) 0.823 0.22 1.28 0.07 1.72 0.96 0.98
U Aff 0.36 0.072 0.86 -1.88 0.96 -3.09 0.46 -2.07
MAF: Minor Allele Frequency; Aff = Affected; U Aff: Un-affected

Table 5: Summary statistical analysis of SNP (-344 C >T; rs1799998) of CYP11B2 gene by General association, HWE and binary logistic regression.

Several studies of the association between this polymorphism and hypertension [10,27,38,39] left ventricle size and mass [18,40] and myocardial infarction [28,37] in the general population and hypertensive individuals with normal renal function have been performed. Various studies had reported the CYP11B2 gene polymorphism associated with CRI [5]; renal insufficiency in the hypertensive population [10,31] and [30] reported that there was no association between the CYP11B2 genotype and progression of renal failure among the diabetic ESRD patients.

In ESRD patients, however, studies of association of CYP11B2 -344C>T polymorphism and left ventricular hypertrophy and cardiovascular morbidity are few. It is also possible that the type 2 diabetic patients with high risk genotype may be excluded from the present study because of premature mortality due to cardiovascular influences by CYP11B2 polymorphism. Thus, further prospective investigation is needed to explore the role of CYP11B2 polymorphism in the susceptibility of diabetes and cardiovascular effect in type 2 diabetic patients.

Conclusion

Our findings do not support the hypothesis that CYP11B2 polymorphism is associated with prevalence of Type 2 Diabetes and diabetic nephropathy patients in Indian populations. The minor T allele of CYP11B2 gene polymorphism is not associated with T2DNH in Indian subjects. Therefore, CYP11B2 gene (-344 C>T) polymorphism may not be a genetic marker and might not considered as a genetic risk factor for Indian Type 2 Diabetic nephropathy patients.

Acknowledgements

We would like to thank the members of the study populations. We wish to express our deep gratitude to the Director, Anthropological Survey of India, for his kind permission to initiate the work and also for providing financial support.

References

  1. Perry HM Jr, Miller JP, Fornoff JR, Baty JD, Sambhi MP, et al. (1995) Early predictors of 15-year end-stage renal disease in hypertensive patients. Hypertension 25: 587-594.
  2. Klag MJ, Whelton PK, Randall BL, Neaton JD, Brancati FL, et al. (1996) Blood pressure and end-stage renal disease in men. N Engl J Med 334: 13-18.
  3. Shlush Li, Bercovici S, Wasser WG, Yudkovsky G, Templeton A, et al. (2010) Admixture mapping of end stage kidney disease genetic susceptibility using estimated mutual information ancestry informative markers. BMC Med Genomics 3: 47.
  4. Abbasi M, Chertow GM, Hall YN (2010) Clinical evidence, kidney disorder, end stage renal disease. Clinical Evidence.
  5. Prasad P, Tiwari AK, Prasanna Kumar KM, Ammini AC, Gupta A, et al. (2006) Chronic renal insufficiency among Asian Indians with type 2diabetes: I. Role of RAAS gene polymorphisms. BMC Medical Genetics 7: 42.
  6. Lee JE, Bae SY, Kim JY, Pyo HJ; Western Dialysis Physician Association (WDPA) (2009) Aldosterone Synthase Gene (CYP11B2) Polymorphism in Korean End-Stage Renal Disease Patients on Hemodialysis. Electrolyte Blood Press 7: 67-72.
  7. Saidi S, Mahjoub T, Almawi WY (2010) Aldosterone synthase gene (CYP11B2) promoter polymorphism as a risk factor for ischaemic stroke in Tunisian Arabs. J Renin Angiotensin Aldosterone Syst 11: 180-186.
  8. Vasudevan R , Ali AB, Mansoor MS, Zulkifli NF, Ismail P (2011) Analysis of T344C Genetic Polymorphism of CYP11B2 Gene in Malaysian End Stage Renal Disease Subjects. Research Journal of Biological Sciences 6: 213-218.
  9. Purkait P, Sarkar BN, Naidu JM (2012) Null association of aldosterone synthase (cyp11b2) gene-344 c > t promoter polymorphism in type 2 diabetic patients among Indian population. (Abstract). J Diabetes Metab. 3: 8.
  10. Li W, Liu C (2012) The -344C/T polymorphism in the CYP11B2 gene is associated with essential hypertension in the Chinese. J Renin Angiotensin Aldosterone Syst .
  11. Pan XQ, Zhang YH, Liu YY, Tong WJ (2010) Interaction between the C(-344)T polymorphism of CYP11B2 and alcohol consumption on the risk of essential hypertension in a Chinese Mongolian population. Eur J Epidemiol 25: 813-821.
  12. Vasudevan R, Ismail P, Stanslas J, Shamsudin N, Ali AB (2008) Association of insertion/deletion polymorphism of alpha-adrenoceptor gene in essential hypertension with or without type 2 diabetes mellitus in Malaysian subjects. Int J Biol Sci 4: 362-367.
  13. White PC (1994) Disorders of aldosterone biosynthesis and action. N Engl J Med 331: 250-258.
  14. Curnow KM, Tusie-Luna MT, Pascoe L, Natarajan R, Gu JL, Nadler JL, et al. (1991) The product of the CYP11B2 gene is required for aldosterone biosynthesis in the human adrenal cortex. Mol Endocrinol 5: 1513-1522.
  15. Mornet E, Dupont J, Vitek A, White PC (1989) Characterization of two genes encoding human steroid 11 beta-hydroxylase (P-450(11) beta). J Biol Chem 264: 20961-20967.
  16. Clyne CD, Zhang Y, Slutsker L, Mathis JM, White PC, et al. (1997) Angiotensin II and potassium regulate human CYP11B2 transcription through common cis-elements. Mol Endocrinol 11: 638-649.
  17. Hilgers KF, Schmidt BM (2005) Gene variants of aldosterone synthase and hypertension. J Hypertens 23: 1957-1959.
  18. Kupari M, Hautanen A, Lankinen L, Koskinen P, Virolainen J, et al. (1998) Associations between human aldosterone synthase (CYP11B2) gene polymorphisms and left ventricular size, mass, and function. Circulation 97: 569-575.
  19. Brand E, Chatelain N, Mulatero P, Féry I, Curnow K, et al. (1998) Structural analysis and evaluation of the aldosterone synthase gene in hypertension. Hypertension 32: 198-204.
  20. Mornet E, White PC (1989) Analysis of genes encoding steroid 11-beta hydroxylase. (Abstract) Cytogenet. Cell Genet 51: 1047.
  21. Bassett MH, Zhang Y, Clyne C, White PC, Rainey WE (2002) Differential regulation of aldosterone synthase and 11beta-hydroxylase transcription by steroidogenic factor-1. J Mol Endocrinol 28: 125-135.
  22. Russo P, Siani A, Venezia A, Iacone R, Russo O, et al. (2002) Interaction between the C(-344)T polymorphism of CYP11B2 and age in the regulation of blood pressure and plasma aldosterone levels: cross-sectional and longitudinal findings of the Olivetti Prospective Heart Study. J Hypertens 20: 1785-1792.
  23. Keavney B, Mayosi B, Gaukrodger N, Imrie H, Baker M, et al. (2005) Genetic variation at the locus encompassing 11-beta hydroxylase and aldosterone synthase accounts for heritability in cortisol precursor (11-deoxycortisol) urinary metabolite excretion. J Clin Endocrinol Metab 90: 1072-1077.
  24. White PC, Slutsker L (1995) Haplotype analysis of CYP11B2. Endocr Res 21: 437-442.
  25. Davies E, Holloway CD, Ingram MC, Inglis GC, Friel EC, et al. (1999) Aldosterone excretion rate and blood pressure in essential hypertension are related to polymorphic differences in the aldosterone synthase gene CYP11B2. Hypertension 33: 703-707.
  26. Kumar NN, Benjafield AV, Lin RC, Wang WY, Stowasser M, et al. (2003) Haplotype analysis of aldosterone synthase gene (CYP11B2) polymorphisms shows association with essential hypertension. J Hypertens 21: 1331-1337.
  27. Tamaki S, Iwai N, Tsujita Y, Kinoshita M (1999) Genetic polymorphism of CYP11B2 gene and hypertension in Japanese. Hypertension 33: 266-270.
  28. White PC, Hautanen A, Kupari M (1998) Aldosterone synthase (CYP11B2) polymorphisms and cardiovascular function. Endocr Res 24: 797-804.
  29. Song J, Narita I, Goto S, Saito N, Omori K, et al. (2003) Gender specific association of aldosterone synthase gene polymorphism with renal survival in patients with IgA nephropathy. J Med Genet 40: 372-376.
  30. Lovati E, Richard A, Frey BM, Frey FJ, Ferrari P (2001) Genetic polymorphisms of the renin-angiotensin-aldosterone system in end-stage renal disease. Kidney Int 60: 46-54.
  31. Fabris B, Bortoletto M, Candido R, Barbone F, Cattin MR, et al. (2005) Genetic polymorphisms of the renin-angiotensin-aldosterone system and renal insufficiency in essential hypertension. J Hypertens 23: 309-316.
  32. Rajan S, Ramu P, Shewade DG, Adithan C (2009) Promoter region polymorphism of CYP11B2 (344 C>T) gene in healthy volunteers of South Indian Tamilian population. Indian Journal Biotech. 8: 358-362.
  33. Rajput C, Makhijani K, Norboo T, Afrin F, Sharma M, et al. (2005) CYP11B2 gene polymorphisms and hypertension in highlanders accustomed to high salt intake. J Hypertens 23: 79-86.
  34. Rajan S, Ramu P, Umamaheswaran G, Adithan C (2010) Association of aldosterone synthase (CYP11B2 C-344T) gene polymorphism & susceptibility to essential hypertension in a south Indian Tamil population. Indian J Med Res 132: 379-385.
  35. Rajput C, Arif E, Vibhuti A, Stobdan T, Khan AP, et al. (2006) Predominance of interaction among wild-type alleles of CYP11B2 in Himalayan natives associates with high-altitude adaptation. Biochem Biophys Res Commun 348: 735-740.
  36. Miller SA, Dykes DD, Polesky HF (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16: 1215.
  37. Hautanen A, Toivanen P, Mänttäri M, Tenkanen L, Kupari M, et al. (1999) Joint effects of an aldosterone synthase (CYP11B2) gene polymorphism and classic risk factors on risk of myocardial infarction. Circulation 100: 2213-2218.
  38. Sookoian S, Gianotti TF, González CD, Pirola CJ (2007) Association of the C-344T aldosterone synthase gene variant with essential hypertension: a meta-analysis. J Hypertens 25: 5-13.
  39. Cheng X, Xu G (2009) Association between aldosterone synthase CYP11B2 polymorphism and essential hypertension in Chinese: a meta-analysis. Kidney Blood Press Res 32: 128-140.
  40. Sookoian S, Gianotti TF, Pirola CJ (2008) Role of the C-344T aldosterone synthase gene variant in left ventricular mass and left ventricular structure-related phenotypes. Heart 94: 903-910.
Citation: Purkait P, Raychodhury P, Bandhyopadhya S, Naidu JM, Sarkar BN (2013) Analysis of Aldosterone Synthase Gene Promoter (- 344 C >T) Polymorphism in Indian Diabetic Nephropathy Patients. J Diabetes Metab 4:271.

Copyright: © 2013 Purkait P, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.