Biological Systems: Open Access

Wheat is the most widely grown cereal crop globally after maize and rice which provides 21% of food calories and 20% of the protein for more than 4.5 billion people in 94 developing countries [1]. The rust diseases of wheat, i.e., leaf rust, stripe rust, and stem rust are major biotic constraints in the world [2]. Stem rust, caused by Puccinia graminis f. sp. tritici , is one of the most destructive diseases of wheat. Stem rust epidemics have resulted in as much as 50% yield losses in recent years [3], A new race of the pathogen named TTKSK (syn. Ug99) detected in Uganda in 1999 [4] and its variants are virulent to many designated and undesignated stem rust resistance genes, losses due to Ug99 can be as high as 90% [3]. An effective method to combat emergence and spread of Ug99 races would be to stack several broadly effective resistance genes into new adapted variety using marker assisted breeding (MAB). Success of gene pyramiding depends on the availability of molecular markers tightly linked to resistance genes Sr22 , Sr26 , Sr25 and Sr35 that confer resistance to Ug99 and other virulent races [5] and breeding efforts to pyramid these genes are already underway.

Sr26 is one the few known major resistance genes effective against the Sr31 -virulent race Ug99 (TTKSK). Sr26 was transferred from Knott’s Agropyron elongatum Thatcher stock [6] into Australian cultivars such as Eagle, Kite and Jabiru. Translocation lines with shorter Agropyron elongatum segments were developed that have been observed not to exhibit the reported 9% yield penalty associated with the Sr26 segment. The effectiveness of this gene against the TTKS family of races, its low frequency among Indian cultivars and the availability of donor lines with shortened alien segment makes Sr26 ideal for use in MAB. Several DNA markers linked to various stem rust resistance genes in wheat have been identified and developed. The genes include Sr2 [7,8], Sr1RAmigo [9], Sr6 [10], Sr9a [11], Sr24 [9,12], Sr25 [13], Sr26 [12,13], Sr31 [14], Sr35 [15], Sr36 [16], Sr38 [17], Sr39 [18], Sr40 [19]. These molecular markers help in deployment of several resistance genes in single cultivar which is otherwise a timeconsuming method if done using rust reaction in field condition. Molecular markers might simulate selection gain [20] because they can be assessed in high-throughput techniques at a very early growth stage with high heritability and they are relatively cheap [21]. They can be used to characterize parental material better, thereby improving the efficiency and effectiveness of parental selection for crossing and to track genes in segregating progenies through the selection process. The marker reported in this study is based on co-segregation study for stem rust resistance conferred by Sr26 and hence the results and procedures may be applied for use in MAS. It will assist in the stacking of resistance gene with other broadly effective resistance genes in order to develop wheat lines with potentially stable and durable stem rust resistance.

Plant materials

A total of 45 wheat genotypes (seeds were procured from IARI, New Delhi; DWR, Karnal and NBPGR, IIWBR Regional Station (previously DWR Regional Station), Flowerdale, Shimla) were used for validation of marker in this study (Table 1) of which 12 were carriers of Sr26 and remaining 33 were non-carriers of Sr26 . A segregating F2 population was developed from cross between Kalyan Sona (susceptible) and Kite (resistant; +Sr26 ). Another cross was made between Kalyan Sona and Takari (+Sr26 ) for validation of the marker.

Table 1: List of wheat genotypes used for validation of marker.

Stem rust inoculation and scoring: Seedlings in field plots, about one month old were inoculated with the pathotype 122 (7G-11, obtained from IIWBR, Regional Station, Flowerdale, Shimla) and disease reactions on the leaves of each plant were recorded at 14 days after inoculation using disease rating scale [22]. To ensure heavy inoculums build-up of stem rust, Cv. Agra Local rows were planted and artificially inoculated with stem rust collected from experimental plots in the previous year. F3 generation rows corresponding to F2 generation plants were also scored for rust resistant phenotype and were characterizing as (RR, rr, Rr) homozygous for resistance or susceptibility, or segregating for resistance to stem rust and also deduce the genotype of respective F2 individuals.

DNA isolation, RAPD and Gel electrophoresis: DNA was extracted from the non-inoculated, fully expanded, 21 days old leaves according to Eswaran et al. [23]. RAPD analysis was carried out using 100 random decamer primers procured from Operon Technologies Inc., Alamaenda, CA, USA (kits A, B, C, D, E). The PCR reactions were performed in 25 μl volume, containing 10 mm Tris-HCl (pH 9.0), 2.0 mm MgCl₂, 50 mm KCl, 200 μm of each dNTP, 25 pmol of primer, 1.0 Unit of Taq DNA polymerase (Bangalore Genei Pvt. India Ltd.) and 50 ng of template DNA. The PCR was carried out in Mastercycler gradient PCR machine (Eppendorf) using the following thermal profile: 94°C – 5 min, 42°C – 5 min, 72°C – 5 min (one cycle); 94°C – 1 min, 42°C – 1 min, 72°C – 1 min (45 cycles); final extension at 72°C – 10 min.

SCAR primer design and analysis: For developing SCAR markers the desired band was isolated, cloned and sequenced using primers SCOPAE07620F: 5’ (AGTGGCAACTCGTCGGTGT) 3’ and SCOPAE07620R: 5’ (GTGTCAGTGAGAGTAAAGCGTAGGT) 3’). The PCR amplification was carried out in a 25 μl reaction mixture containing 8.0 pmol of each primer, 1.5 mm MgCl₂ and 50 ng of genomic DNA while the rest of the PCR components were the same. The thermal cycling conditions were as follows: 1 cycle of 95°C – 5 min, 60°C – 1 min, 72°C – 30 s; 35 cycles of 95°C – 1 min, 60°C – 1 min and 72°C – 30 s and a final extension at 72°C – 10 min.

Identification of RAPD marker for the Sr26 gene: A RAPD primer OPAE07 (5’ GGAAAGCGTC 3’) displayed an amplified DNA fragment of 620 bp designated as OPAE07620 specifically in resistant parent and resistant F2 individuals possibly carrying Sr26 gene while absent in possibly non-carriers of the Sr26 gene (Figure 1).

Figure 1: Segregation of RAPD marker OPAE07620 in the F2 population derived from the cross between Kalyan Sona (susceptible) X Kite (resistant carrying Sr26 gene). Lanes marked Ks and Ki indicate Kalyan Sona and Kite respectively. Lanes marked ‘R’ and ‘S’ represents resistant and susceptible individuals. M=100 bp DNA ladder.

Linkage analysis: A F2 population of 120 plants (Kalyan Sona × Kite) was analysed for segregation of marker and rust resistance phenotypes. In the F2 population, phenotypic ratio of segregation as resistant to susceptible plants and presence of OPAE-07620 to its absence were observed to be 3:1 (Table 2) and showed a good fit to 3:1 ratio (χ2=0.711 and P=0.80-0.70). Thus, suggesting monogenic inheritance and dominant action of Sr26 gene.

Table 2: Phenotypic segregation ratio and χ² test for rust reaction in F2 population derived from the cross Kalyan Sona X Kite.

SCAR marker analysis and validation: SCAR marker (SCOPAE07620) is a dominant marker and showed a tight linkage with the rust resistance phenotype yielded 620 bp band in Kite and resistant F2 plants which was absent in Kalyan Sona and susceptible F2 plants (Figure 2 and Table 2). Based on sequence data of the cloned RAPD marker and using software Primer 3.0, primers were designed and were synthesized by Numex Chemicals, Mumbai, India.

Figure 2: SCAR marker SCOPAE07620 analysis of parents and F2 population of cross between Kalyan Sona and Kite. Lanes marked R and S indicates resistant and susceptible F2 individuals respectively. The arrow indicates the position of the SCAR marker. M=100 bp DNA ladder.

Validation of SCAR marker: The SCAR marker SCOPAE07620 was validated using 45 wheat genotypes with known Sr26 status. The SCAR marker was present in all 12 carriers of Sr26 gene while absent in remaining 33 non-carriers of Sr26 gene (Table 1). Validation was also done on other segregating population for Sr26 gene obtained from cross between Kalyan Sona X Takari (resistant: carrying Sr26 gene). The presence or absence of the marker co-segregated with the phenotypic status in the validating population.

The reported SCAR marker SCOPAE07620 was developed using a cross between Indian cultivar with a carrier of Sr26 gene of Australian origin. Hence this marker will be very valuable in Indian wheat breeding programme and its extensive use can be facilitated by transferring this gene in combination with other genes for enhancement of durability of rust resistance in the wheat lines. During the course of our research, Mago et al. [12] have reported AFLP marker for stem rust resistance gene Sr26 using pair of NILs, however they did not include the co-segregation studies of marker with the phenotypic scoring in an appropriate segregating population. Also linkage analysis of the marker was not done and marker was only associated with the resistance gene. Liu et al. [13] also developed a diagnostic and co-dominant markers for Sr26 using multiplex PCR. The marker reported in this study is a co-dominant SCAR marker tightly linked (5.7 cm) to the resistance gene which minimizes the risk of recombination separating the marker from the gene. Marker is polymorphic between gene donor as well as wide range of crop genotypes. Repeatability and reliability of marker was tested and validated on segregating population of appropriate size and hence it is useful for MAS. This study is based on association genetics of the obtained marker with the phenotypic scoring in a F2 segregating population of 120 individuals. The population size is large enough for obtaining linkage between marker and trait of interest. The marker obtained here is 5.7 cm away, thus it is co-inherited with the disease resistance gene Sr26 which is dependent on the genetic proximity of this marker and the desired gene and can be effectively used in marker assisted selection. The newly identified marker was confirmed by validating it on another segregating population of cross between Kalyan Sona and Takari (carrying Sr26 ) and wheat genotypes with different Sr26 status. This marker did not amplify in genotypes carrying other stem resistance genes confirming that it can be effectively used in marker assisted selection.

Ruchi Rai thanks CSIR-UGC for providing JRF-SRF fellowship. I would also like to thank Dr. SFD Souza, former Head, NABTD; IARI, New Delhi; IIWBR (DWR), Karnal and NBPGR, New Delhi for supplying the seeds of wheat genotypes and to the IIWBR (DWR) Regional Station, Flowerdale, Shimla for providing the stem rust race 7G-11 and screening for Sr26 in theF3 progenies.