Journal of Diabetes & Metabolism

Herbal Anti-Hyperglycemic Compound Increases Expression of Glucose Transporter Molecules in Diabetic Rats

Author info »

Introduction

Mammalian cells utilize glucose for the generation of energy in the form of ATP. With the help of glucose transporter proteins, the blood glucose is taken up by the mammalian cells which are encoded by the SLC2 genes [1,2].

GLUT-4 is the primary glucose transporter responsible for insulin stimulated glucose uptake into muscle and adipose tissues. Studies have reported that during diabetes, the insulin-stimulated glucose uptake by GLUT-4 is largely hampered in muscle and adipose tissue leading to the development of insulin resistance. Studies have also reported that over expression of GLUT-4 in the adipose tissue of GLUT-4 knockout mice ameliorate insulin resistance, diabetes and enhance insulin sensitivity [3-6].

On the other hand GLUT-8 is an intracellular transporter which is responsible for the transport of various hexoses such as glucose, fructose and galactose inside the cell. It is found to be present in high quantities in testis, brain, spleen, liver, heart, skeletal muscle, and adipose tissue. GLUT-8 has been found to be associated with various intracellular compartments such as rough endoplasmic reticulum, Trans Golgi, late endosomes and lysosomes, potentially catalyzing transport of sugars and sugar derivatives into or out of intracellular organelles [7].

Studies have reported that Potassium channels also play an important role in glucose-stimulated insulin secretion from the pancreatic beta cells [8,9]. Previous studies showed that gene inactivation or pharmacological inhibition of Kv 1.3 channel activity increased peripheral insulin sensitivity by augmenting the amount of GLUT-4 at the plasma membrane [10,11]. Studies have also reported that potassium channel gene knockout mice demonstrated lower body weight, higher insulin sensitivity, and improved glycemic profile [10,11]. Thus, the modulation of K+ channel is also a therapeutic approach in the treatment of T2DM.

Studies have reported that adiponectin plays a key role in the suppression of metabolic derangements which results in insulin resistance and T2DM [12]. It also demonstrates a negative correlation with body fat mass and has been found in lower levels in obese subjects as compared to non-obese subjects [13]. Adiponectin has also been reported to be inversely correlated with obesity and low adiponectin level predicts the future development of T2DM [14]. Studies have also reported that overexpression or administering recombinant adiponectin reduces blood glucose levels and ameliorates insulin resistance in obese mice, which are independent of plasma insulin levels [15,16]. Conversely, ablation of the adiponectin gene exacerbates insulin resistance and hyperglycemia in mice fed on a high-fat diet [17-19].

On the other hand, Tumour Necrosis Factor-α (TNF-α) is an inflammatory cytokine secreted by adipocytes. Its overproduction has been reported to be associated with insulin resistance by disrupting insulin signaling pathways [20,21]. PPAR-γ agonists down regulate the expression of TNF-α in adipose tissue and improve TNF-α induced desensitization to insulin action [22,23]. Hence these two cytokines affect the glycemic control by affecting insulin signaling by up regulating/down regulating the PPAR-γ activity. In previous studies, Sharma et al, has already isolated the active anti-hyperglycemic compound known as alpha hydroxy succinamic acid (FIIc) (US Patent no. 6,426,826 dated 6th August 2002; Indian Product Patent no. 2,30,753 February 2009) from the fruit pulp of Eugenia Jambolana [24]. Hence this study was designed to estimate the effect of active herbal compound (FIIc) on peripheral insulin sensitivity by measuring the expression levels of GLUT-4, GLUT-8 and Kv 1.3 Potassium channel at mRNA and at protein level in streptozotocin induced diabetic rats.

Materials and Methods

Isolation and purification of active anti-hyperglycemic compound (FIIc)

Active anti-hyperglycemic compound was isolated from the fruit pulp of Eugenia Jambolana by applying Ion exchange chromatography technique. Diethyl Amino Ethyl cellulose-52 (DEAE-52) was used as the stationary phase. This technique was described in detail in the previous studies reported by Sharma et al. [24,25]. From 1 kg of E. jambolana fruit, the pulp obtained was about 650 g. From this pulp the yield of lyophilized water extract obtained was about 10 g.

Experimental animals

Male Wistar albino rats (weighing 220-250 g) were procured from Central Animal House of University College of Medical Sciences (UCMS), University of Delhi, India. The animals were housed in standard conditions of temperature (22 ± 2°C) and at 12 hour lightdark cycle. The rats were fed with commercial diet (Hindustan liver Ltd., Mumbai) and water ad libitum. The experimental protocol was approved by the Institutional Animal Ethical Committee (IAEC), UCMS, Delhi, India (UCMS/IAEC/26 granted on 30th December 2009).

Induction of diabetes

To induce diabetes, a freshly prepared solution of streptozotocin (45 mg/kg of b.w. in 0.1 M citrate buffer, pH 4.5) was injected intraperitoneally to overnight fasted rats. Nicotinamide at a dose of 230 mg/kg b.w. was given 15 minutes prior to STZ injection for the development of stable type 2 diabetes mellitus [26]. After 48 hours of STZ administration, fasting blood glucose (FBG) levels were measured for the confirmation of diabetes.

Study design

Male Wistar rats were taken for the present study and divided into following groups (6 rats each group).

• Group A: Healthy control rats administered with normal saline

• Group B: Diabetic control rats administered with normal saline

• Group C: Diabetic treated rats administered with FIIc (20 mg/ kg of b.w.)

• Group D: Diabetic treated rats administered with Pioglitazone (20 mg/kg of b.w.)

All the animals were fed on standard chow diet. Purified active compound (FIIc) was given orally to group C at a dose of 20 mg/ kg of body weight/day and Pioglitazone was given as a standard drug orally at a dose of 20 mg/kg of body weight/day for 6 weeks to group D respectively for 6 weeks. This is the effective dose of FIIc standardized in previous studies reported by Sharma et al [24,25]. An equal volume of vehicle was given to healthy control group A and diabetic untreated group B at week 0 and at week 6. Blood was drawn after overnight fasting for the estimation of serum Adiponectin and TNF α at week 0 and at week 6 of the study. At the end of the study, animals were sacrificed using CO₂ inhalation and their liver, skeletal muscles and adipose tissues were dissected out, frozen in liquid nitrogen and stored at -80°C for the estimation of gene expression.

RNA isolation and cDNA preparation

Total RNA was isolated from liver, adipose and skeletal muscles with the help of Trizol reagent, (Thermo Scientific, USA), by using modified Chomczynski and Sacchi method [27]. The RNA yield obtained was of high quality (A 280/260 was 1.90 to 1.95). The concentration of RNA sample obtained was between 4000 ng/μl to 5000 ng/μl. For cDNA preparation we have used First strand cDNA synthesis kit (Thermo Scientific, USA) and only 0.1 μg to 0.5 μg of RNA per sample was used. For cDNA amplification we have used Master cycler nexus gradient thermal cycler (Eppendorf AG, Germany). Cycling programs were 90°C for 2 minutes followed by 25°C for 5 minutes, 45°C for 60 minutes and a final extension of 70°C for 5 minutes. This cycle was repeated for 40 times.

Real time PCR

For the real time PCR amplification we have used Thermo Scientific Maxima SYBR Green (2X) master mix reagent kit and Qiagen QPCR Rotor Gene 2 Plex with HRM real time PCR machine, Australia. The denaturation step was done at 95°C followed by annealing step at 50°C for all the primers and amplification step at 70°C. This cycle was repeated for 35 times. The following primer sequences were used for the real time PCR amplification.

Glut 4 primer sequence,

Forward Primer-5’CTCATGGGCCTAGCCAATG 3’ Reverse Primer-5’GGGCGATTTCTCCCACATAC 3’

Glut 8 primer sequence,

Forward primer-5’TCATGGACAGAGCAGGGCG 3’ Reverse Primer-5’GCCAGCCAGGCCAGCCCCA 3

Kv 1.3 potassium channel primer sequence,

Forward primer-5’AGTATATGGTGATCGAAGAGG 3’, Reverse Primer-5’AGTGAATATCTTCTTGATGTT 3’:

Rat tubulin primer sequence,

Forward primer-5’TAGCAGAGATCACCAATGCC 3’, Reverse Primer-5’ GGCAGCAAGCCATGTATTTA 3’

Immuno histochemical studies

The quantitative expression at protein level of GLUT-4 and Kv 1.3 Potassium Channel was studied in skeletal muscles while the expression at protein level of GLUT-8 was studied in liver tissues in all the study groups. Rats were sacrificed at the end of the study by CO2 inhalation and their Liver and skeletal muscles were dissected out and fixed in 10% buffered formalin. The tissues were then processed for paraffin embedding, 4 μm thin sections on lysinated slides were prepared for immunohistochemical staining by indirect avidin-biotin peroxidase method. Briefly, slides were deparaffinized using xylene, endogenous peroxidase was blocked by using 3% H2O2 in methanol for 30 minutes at room temperature. Heat-mediated antigen retrieval was carried out at 95°C in citrate buffer at pH 6 for 25 minutes. After antigen retrieval the slides were washed 3 times with Tris buffer (3%) for 5 minutes and incubated in milk powder in Tris buffer for 20 minutes at room temperature. Primary antibody (Santa Cruz, USA) was added to the slide sections and were incubated overnight at 4°C. Next day immunoreaction sites were visualized by using appropriate biotinylated secondary antibody and tertiary antibody conjugated with avidin-biotinperoxidase complex. The dilutions used were as follows-(GLUT 4-1:200, GLUT 8-1:50, Kv 1.3 Potassium Channel-1:150). The slides were counter stained with haematoxylin and the peroxidase activity was revealed with a solution of diaminobenzidine (DAB) followed by microscopical examination.

Statistical analysis

The statistical analysis was carried out by using analysis of variance (ANOVA) followed by tukey’s test.

Results

Table 1 depicts no significant difference in baseline serum Adiponectin and TNF-α level among the four study groups. However, after the induction of diabetes, serum adiponectin levels were found to be significantly decreased in diabetic controls as compared to healthy controls at week 6 of the study. After treatment with FIIc, group C treated rats showed increased serum adiponectin level at week 6 of the study as compared to diabetic controls although it is found to be statistically not significant. Similarly, after the treatment with pioglitazone, group D rats also showed increased serum adiponectin level at week 6 of the study as compared to diabetic controls. It is also found to be statistically not significant (Table 1).

Table 1: Serum Adiponectin and serum TNF-α level at week 0 and week 6 after treatment with FIIc and Pioglitazone.

At week 6 of the study serum TNF α levels were found to be significantly increased in diabetic control rats as compared to healthy controls. Among the FIIc treated group, serum TNF-α level were significantly decreased as compared to diabetic controls at week 6 of the study. Similarly, serum TNF-α level were also found to be decreased in group D rats treated with Pioglitazone as compared to diabetic controls, however it is also statistically not significant (Table 1).

As depicted from Figure 1, a 1.28 and 1.98 folds increase in GLUT- 4 mRNA expression levels was observed in group C and D as compared to group B in the skeletal muscles of diabetic rats after treatment with FIIc and Pioglitazone respectively, at week 6 of the study.

Figure 1: Showing GLUT-4 mRNA expression level in skeletal muscle at week 6 after treatment with FIIc and Pioglitazone in Streptozotocin- Nicotinamide induced diabetic animals.

As seen from Figure 2, a 2.67 and 1.23 folds increase in GLUT- 8 mRNA expression levels was observed in group C and D as compared to group B in the liver tissues of diabetic rats after treatment with FIIc and Pioglitazone respectively, at week 6 of the study.

Figure 2: Showing GLUT-8 mRNA expression level in liver tissue at week 6 after treatment with FIIc and Pioglitazone in Streptozotocin-Nicotinamide induced diabetic animals.

As depicted from Figure 3, the mRNA expression levels of Kv 1.3 potassium channel in the skeletal muscles of diabetic rats was found to be at par in all the four study groups after treatment with FIIc and Pioglitazone respectively, at week 6 of the study.

Figure 3: Showing Kv 1.3 Potassium channel mRNA expression level in skeletal muscle at week 6 after treatment with FIIc and Pioglitazone in Streptozotocin-Nicotinamide induced diabetic animals.

In Figure 4, after the induction of diabetes, the GLUT-4 protein expression was found to be decreased in the skeletal muscles of group B rats as compared to healthy controls at week 6 of the study. However, the GLUT-4 protein expression was found to be increased in the skeletal muscles of group C and D rats as compared to group B rats after treatment with FIIc and Pioglitazone respectively, at week 6 of the study.

Figure 4: Showing GLUT-4 protein expression in skeletal muscle at week 6 after treatment with FIIc and Pioglitazone in Streptozotocin-Nicotinamide induced diabetic animals. (Manufacturer-Santa Cruz, USA, Dilution -1:200, Magnification-200X).

In Figure 5, the GLUT-8 protein expression was also found to be decreased in the liver tissues of group B rats as compared to healthy controls at week 6 of the study. However, the GLUT-8 protein expression was found to be increased in the liver tissues of group C and D rats as compared to group B rats after treatment with FIIc and Pioglitazone respectively, at week 6 of the study.

Figure 5: Showing GLUT-8 protein expression in liver tissue at week 6 after treatment with FIIc and Pioglitazone in Streptozotocin-Nicotinamide induced diabetic animals. (Manufacturer-Santa Cruz, USA, Dilution -1:50, Magnification-200X).

In Figure 6, Kv 1.3 potassium channel protein expression measured in liver tissue was found to be at par among all the study groups after treatment with FIIc and Pioglitazone respectively, at week 6 of the study.

Figure 6: Showing Kv 1.3 Potassium channel protein expression in skeletal muscle of Streptozotocin-Nicotinamide induced diabetic rats after treatment with FIIc and Pioglitazone at week 6 of the study (Manufacturer- Santa Cruz, USA, Dilution -1:150, Magnification-200X).

Discussion

This study was designed to estimate the effect of active herbal compound FIIc and pioglitazone on the parameters of peripheral insulin sensitivity such as GLUT-4, GLUT-8 and Kv 1.3 Potassium channel at mRNA and at protein levels in streptozotocin induced diabetic rats.

In this study we observed that after the induction of diabetes, GLUT-4 mRNA expression was found to be decreased in the skeletal muscles of group B, C and D rats as compared to healthy controls at week 6 of the study. However, the GLUT-4 mRNA expression was found to be increased in skeletal muscles by 1.28 and 1.98 fold in group C and group D rats, as compared to diabetic controls after treatment with FIIc and Pioglitazone respectively, at week 6 of the study (Figure 1). Similarly, after the induction of diabetes, the GLUT-8 mRNA expression was also found to be decreased in the liver tissues of group B, C and D rats as compared to healthy controls at week 6 of the study (Figure 2). However GLUT-8 mRNA expression was found to be increased in liver tissues by 2.67 and 1.23 fold in group C and group D rats as compared to diabetic controls after treatment with FIIc and Pioglitazone respectively, at week 6 of the study (Figure 2). No change was observed in the Kv 1.3 Potassium channel mRNA expression level and it was found to be at par in all the study groups after treatment at week 6 of the study (Figure 3).

After conducting immunohistochemistry, the GLUT-4 protein expression was found to be increased in skeletal muscles in group C and group D as compared to group B after treatment with FIIc and Pioglitazone respectively, at week 6 of the study (Figure 4). Similarly, GLUT-8 protein expression in liver tissue was also found to be increased in group C and group D as compared to group B after treatment with FIIc and Pioglitazone respectively, at week 6 of the study (Figure 5). However, the Kv 1.3 potassium channel protein expression was found to be similar in all the study groups at week 6 of the study (Figure 6).

The initial base line serum adiponectin and TNF-α level were found to be in normal range in all the study groups. However, after the induction of diabetes, a significant decrease in serum adiponectin and increase in serum TNF-α level in group B rats was observed, as compared to healthy controls at week 6 of the study. After treatment with active compound FIIc and Pioglitazone in group C and D respectively, an increase in serum adiponectin levels was observed at week 6 of the study as compared to group B. However, the difference is found to be statistically insignificant. Similarly, serum TNF-α level were also found to be significantly decreased in group C and D compared to group B at week 6 of the study (Table 1).

Adipose tissue and skeletal muscle play an important role in the regulation of insulin-mediated glucose homeostasis. It has been reported that glucose transport into skeletal muscles has been impaired in insulin resistance [28,29] through inhibition of GLUT-4 translocation to the cell membrane [30]. Studies have also reported adipose specific GLUT-4 gene knockout results in insulin resistance in muscle and liver [31]. Development of insulin resistance and glucose intolerance has also been observed in muscle specific GLUT-4 gene knockout animal models [32]. Studies have also reported that muscle-specific over expression of GLUT-4 ameliorated insulin action in diabetic mice [33,34], which may be an outcome of increased accumulation of GLUT-4 at the cell membrane [34]. There are various studies which have reported that treatment with herbal drugs resulted in increased glucose transporter levels in diabetic animal models [35-39].

In our study, the possible explanation of increased GLUT- 4 expression after treatment with FIIc is attributed through phosphorylation and activation of AMPK which leads to increased expression and translocation of GLUT-4 to the cell membrane in skeletal muscle. As reported by Bao et. al. [40] while studying the effect of Catalpol, an iridoid glycoside isolated from the root of Rehmanniae glutinosa on diabetic mice. He observed that Catalpol ameliorated diabetes, insulin resistance and increased the expression of GLUT-4 in diabetic mice. Studies have reported the importance of AMPK a serine/threonine protein kinase, as a key drug target in diabetes due to its role in modulation of glucose metabolism [41]. In animal model of diabetes the levels of p-AMPK has found to be decreased in the peripheral tissue [42]. After treatment with Catalpol the expression of p-AMPK and GLUT-4 were found to be increased as compared to controls. It is proposed to be mediated via phosphorylation and activation of AMPK which in turn increases the translocation of GLUT-4 from intracellular storage vesicles to cell membrane in skeletal muscle and adipose tissues [43,44]. Similar results have been reported by Choi et. al. [45] and Kumar et. al. [46]. In our study we also observed increased expression of GLUT-4 in the skeletal muscles of FIIc treated rats. Hence we hypothesize that the same mechanism might be operating in FIIc treated rats leading to increased expression of GLUT-4 in skeletal muscles. Pioglitazone treated rats also showed similar results rats at week 6 of the study.

We have also observed increased GLUT-8 expression in the liver tissues of FIIc treated rats as compared to diabetic controls at week 6 of the study. Previous studies have reported increased GLUT-8 expression in the mid piece region and its translocation to acrosomal region after insulin stimulation in spermatozoa [47]. Studies have also reported reduced GLUT-8 motility and mitochondrial potential of spermatozoa after targeted disruption of GLUT-8 [7]. Studies have also reported that translocation of GLUT-8 from intracellular compartments to the cell membrane takes place in insulin-treated blastocysts [47,48]. It has also been reported that insulin through the activation of PI3K, results in phosphorylation of PKB/Akt, which in turn leads to increased GLUT-8 translocation to the plasma membrane [48]. This results in increased glucose uptake, and increased glycemic control. In our study we have observed increased beta cell mass and insulin levels after treatment with FIIc. Hence, we hypothesize that the increased serum insulin levels might be responsible for increased GLUT-8 expression and translocation in the liver tissues.

Studies have also reported that an edible Chinese medicinal herb known as Radix Astragali were frequently used as a traditional medicine to treat various diseases including diabetes from past many centuries [49-51]. The authors reported that upon treatment with herbal drug a significant elevation of serum adiponectin was observed which was associated with a significant improvement in hyperglycemia, insulin resistance, and glucose intolerance in both dietary and genetic obese mice. Increased serum adiponectin also attenuates TNF-α secretion from macrophages and adipocytes which suggest that adiponectin may work as anti atherogenic agent. Unlike the PPAR-γ agonists, long-term treatment with Chinese herbal drug for 6 weeks does not cause undesirable weight gain [49-51]. Hence in consonance with the previous studies, we have observed increased serum adiponectin and significantly decreased TNF-α levels in group C and D rats treated with FIIc and Pioglitazone respectively, compared to group B at week 6 of the study.

However we have not observed any difference in the expression of Kv 1.3 at mRNA & at protein level in skeletal muscles in the four study groups at week 6 of the study. Hence, we hypothesize that the possible mechanism of action of FIIc is mediated through the up regulation of serum insulin and glucose transporters activity.

Conclusions

1. After the induction of diabetes, the expression of GLUT-4 and GLUT-8 at mRNA and at protein level was found to be reduced in group B rats as compared to healthy controls at week 6 of the study.

2. However, the expression of GLUT-4 and GLUT-8 was found to be increased at mRNA level in FIIc and Pioglitazone treated rats as compared to diabetic controls at week 6 of the study.

3. Immuno-histochemical studies showed increased GLUT-4 and GLUT-8 expression at protein level in FIIc and Pioglitazone treated rats as compared to diabetic controls at week 6 of the study.

4. No significant difference was observed in the expression of Kv 1.3 potassium channel at mRNA and at protein level after treatment with FIIc and Pioglitazone among the four study groups at week 6 of the study.

A significant decrease in TNF-α level in FIIc treated rats as compared to diabetic controls was observed at week 6 of the study.

Acknowledgements

The authors acknowledge Indian Council of Medical Research, Ansari Nagar, New Delhi for their financial support.

Conflicts of Interest

The authors declare that they have no conflict of interest.

References

1. Zhao FQ, Keating AF. Functional properties and genomics of glucose transporters. Curr Genomics. 2007;8:113-128.
2. Thorens B, Mueckler M. Glucose transporters in the 21st Century. Am J Physiol Endocrinol Metab. 2010;298:141–145.
3. Huang S, Czech MP. The GLUT 4 glucose transporter. Cell Metab. 2007;5:237-252.
4. Atkinson BJ, Griesel BA, King CD, Josey MA, Olson AL. Moderate GLUT 4 Over expression Improves Insulin Sensitivity and Fasting Triglyceridemia in High-Fat Diet–Fed Transgenic Mice. Diabetes. 2013;62:2249-2258.
5. Deng D, Yan N. GLUT, SGLT, and SWEET: Structural and mechanistic investigations of the glucose transporters. Protein Sci. 2016;25:546-558.
6. Byers MS, Howard C, Wang X. Avian and Mammalian Facilitative Glucose Transporters. Microarrays. 2017;6:pii:E7.
7. Gawlik V, Schmidt S, Scheepers A, Wennemuth G, Augustin R, Aumüller G, et. al. Targeted disruption of Slc2a8 (GLUT 8) reduces motility and mitochondrial potential of spermatozoa. Mol Membr Biol. 2008;25:224-235.
8. Fu Z, Gilbert ER, Liu D. Regulation of Insulin Synthesis and Secretion and Pancreatic Beta-Cell Dysfunction in Diabetes. Curr diabetes Rev. 2013;9:25-53.
9. Fridlyand LE, Jacobson DA, Philipson LH. Ion channels and regulation of insulin secretion in human β-cells: A computational systems analysis. Islets. 2013;5:1-15.
10. Xu J, Wang P, Li Y, Li G, Kaczmarek LK, Wu Y, et. al. The voltage-gated potassium channel Kv1.3 regulates peripheral insulin sensitivity. Proc Natl Acad Sci USA. 2004;101:3112-3117.
11. Li Y, Wang P, Xu J, Desir GV. Voltage-gated potassium channel Kv1.3 regulates GLUT 4 trafficking to the plasma membrane via a Ca2+ dependent mechanism. Am J Physiol Cell Physiol. 2006;290:345-351.
12. Sheng T, Yang K. Adiponectin and its association with insulin resistance and type 2 diabetes. J Genet Genomics. 2008;35:321-326.
13. Arita Y, Kihara S, Ouchi N, Takahashi M, Maeda K, Miyagawa J, et. al. Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. Biochem Biophys Res Commun. 2012;425:560–564.
14. Han SH, Sakuma I, Shin EK, Koh KK. Antiatherosclerotic and anti-insulin resistance effects of adiponectin: basic and clinical studies. Prog Cardiovasc Dis. 2009;52:126–140.
15. Fruebis J, Tsao TS, Javorschi S, Ebbets-Reed D, Erickson MR, Yen FT, et. al. roteolytic cleavage product of 30-kDa adipocyte complement-related protein increases fatty acid oxidation in muscle and causes weight loss in mice. Proc Natl Acad Sci USA. 2001;98:2005-2010.
16. Yamauchi T, Kamon J, Waki H, Imai Y, Shimozawa N, Hiokit K, et. al. Globular adiponectin protected ob/ob mice from diabetes and ApoE-deficient mice from atherosclerosis. J Biol Chem. 2003;278:2461-2468.
17. Kubota N, Terauchi Y, Yamauchi T, Kubota T, Moroi M, Matsui J, et. al. Disruption of adiponectin causes insulin resistance and neointimal formation. J Biol Chem. 2002;277:25863-25866.
18. Maeda N, Shimomura I, Kishida K, Nishizawa H, Matsuda M, Nagaretani H, et. al. Diet-induced insulin resistance in mice lacking adiponectin/ACRP30. Nat Med. 2002;8:731-737.
19. Nawrocki AR, Rajala MW, Tomas E, Pajvani UB, Saha AK, Trumbauer ME, et. al. Mice lacking adiponectin show decreased hepatic insulin sensitivity and reduced responsiveness to peroxisome proliferator-activated receptor gamma agonists. J Biol Chem. 2006;281:2654-2660.
20. Hotamisligil GS, Arner P, Caro JF, Atkinson RL, Spiegelman BM. Increased adipose tissue expression of tumor necrosis factor-alpha in human obesity and insulin resistance. J Clin Invest. 1995;95:2409-2415.
21. Hotamisligil GS, Shargill NS, Spiegelman BM. Adipose expression of tumor necrosis factor-alpha: direct role in obesity-linked insulin resistance. Science. 1993;259:87–91.
22. Dworzanski T, Celinski K, Korolczuk A, Slomka M, Radej S, Czechowska G, et. al. Influence of the peroxisome proliferator-activated receptor gamma (PPAR-γ) agonist, rosiglitazone and antagonist, biphenol-A-diglicydyl ether (BADGE) on the course of inflammation in the experimental model of colitis in rats. J Physiol Pharmacol. 2010;61:683-693.
23. Tyagi S, Gupta P, Saini AS, Kaushal C, Sharma S. The peroxisome proliferator-activated receptor: A family of nuclear receptors role in various diseases. J Adv Pharm Technol Res. 2011;2:236-240.
24. Tanwar RS, Sharma SB, Singh UR, Prabhu KM. Anti-atherosclerotic Potential of Active Principle Isolated from Eugenia jambolana in Streptozotocin-Induced Diabetic Rats. Evid Based Complement Alternat Med. 2011;2011:127641.
25. Jafri AA, Sharma SB, Singh UR, Luthra K. Herbal Anti-Hyperglycemic Compound Improves Glycemic Control and Insulin Sensitivity in Diabetic Rats. J Diabetes Obes. 2016;3:1-6.
26. Szkudelski T. Streptozotocin-nicotinamide-induced diabetes in the rat. Characteristics of the experimental model. Exp Biol Med (Maywood). 2012;237:481-490.
27. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156-159.
28. Hollenbeck CB, Chen YD, Reaven GM. A comparison of the relative effects of obesity and non-insulin dependent diabetes mellitus on in vivo insulin-stimulated glucose utilization. Diabetes. 1984;33:622–626.
29. Pendergrass M, Bertoldo A, Bonadonna R, Nucci G, Mandarino L, Cobelli C, et. al. Muscle glucose transport and phosphorylation in type 2 diabetic, obese nondiabetic, and genetically predisposed individuals. Am J Physiol Endocrinol Metab. 2007;292:92-100.
30. Hansen PA, Han DH, Marshall BA, Nolte LA, Chen MM, Mueckler M, et. al. A high fat diet impairs stimulation of glucose transport in muscle. Functional evaluation of potential mechanisms. J Biol Chem. 1998;273:26157-26163.
31. Abel ED, Peroni O, Kim JK, Kim YB, Boss O, Hadro E, et. al. Adipose-selective targeting of the GLUT4 gene impairs insulin action in muscle and liver. Nature. 2001;409:729-733.
32. Zisman A, Peroni OD, Abel ED, Michael MD, Mauvais-Jarvis F, Lowell BB, et. al. Targeted disruption of the glucose transporter 4 selectively in muscle causes insulin resistance and glucose intolerance. Nat Med. 2000;6:924-928.
33. Leturque A, Loizeau M, Vaulont S, Salminen M, Girard J. Improvement of insulin action in diabetic transgenic mice selectively over expressing GLUT 4 in skeletal muscle. Diabetes. 1996;45:23–27.
34. Tsao TS, Burcelin R, Katz EB, Huang L, Charron MJ. Enhanced insulin action due to targeted GLUT4 over expression exclusively in muscle. Diabetes. 1996;45:28–36.
35. Lai DM, Tu YK, Liu IM, Chen PF, Cheng JT. Mediation of beta-endorphin by ginsenoside Rh2 to lower plasma glucose in streptozotocin-induced diabetic rats. Planta Med. 2006;72:9-13.
36. Gayathri GA, Mahalingam G. Review on enhancement of glucose uptake and up-regulation of glucose transporters by antidiabetic medicinal plants. Asian J Pharm Clin Res. 2016;9:34-39.
37. Nikzamir A, Palangi A, Kheirollaha A, Tabar H, Malakaskar A, Shahbazian H, et al. Expression of glucose transporter 4 (GLUT 4) is increased by cinnamaldehyde in C2C12 mouse muscle cells. Iran Red Crescent Med J. 2014;16:e13426.
38. Prasad CN, Anjana T, Banerji A, Gopalakrishnapillai A. Gallic acid induces GLUT 4 translocation and glucose uptake activity in 3T3-L1 cells. FEBS Lett. 2010;584:531-536.
39. Shih CC, Lin CH, Lin WL, Wu JB. Momordica charantia extract on insulin resistance and the skeletal muscle GLUT 4 protein in fructose-fed rats. J Ethnopharmacol. 2009;123:82-90.
40. Bao Q, Shen X, Qian L, Gong C, Nie M, Dong Y. Anti-diabetic activities of catalpol in db/db mice. Korean J Physiol Pharmacol. 2016;20:153-160.
41. Coughlan KA, Valentine RJ, Ruderman NB, Saha AK. AMPK activation: a therapeutic target for type 2 diabetes? Diabetes Metab Syndr Obes. 2014;7:241-253.
42. Steinberg GR, Kemp BE. AMPK in Health and Disease. Physiol Rev. 2009;89:1025-1078.
43. Kurth-Kraczek EJ, Hirshman MF, Goodyear LJ, Winder WW. 5' AMP-activated protein kinase activation causes GLUT4 translocation in skeletal muscle. Diabetes. 1999;48:1667-1671.
44. Yamaguchi S, Katahira H, Ozawa S, Nakamichi Y, Tanaka T, Shimoyama T, et. al. Activators of AMP-activated protein kinase enhance GLUT4 translocation and its glucose transport activity in 3T3-L1 adipocytes. Am J Physiol Endocrinol Metab. 2005;289:643-649.
45. Choi SI, Lee HA, Han JS. Gynura procumbens extract improves insulin sensitivity and suppresses hepatic gluconeogenesis in C57BL/KsJ-db/db mice. Nutr Res Pract. 2016;10:507-515.
46. Kumar PM, Venkataranganna MV, Manjunath K, Viswanatha GL, Ashok G. Methanolic leaf extract of Gymnema sylvestre augments glucose uptake and ameliorates insulin resistance by upregulating glucose transporter-4, peroxisome proliferator-activated receptor-gamma, adiponectin, and leptin levels in vitro. J Intercult Ethnopharmacol. 2016;5:146-152.
47. Lampiao F, du Plessis SS. Insulin stimulates glut 8 expression in human spermatozoa. J Biosci Tech. 2010;1:90-93.
48. Pinto AB, Carayannopoulos MO, Hoehn A, Dowd L, Moley KH. Glucose transporter 8 expression and translocation are critical for murine blastocyst survival. Biol Reprod. 2002;66:1729-1733.
49. Xu A, Wang H, Hoo RL, Sweeney G, Vanhoutte PM, Wang Y, et. al. Selective elevation of adiponectin production by the natural compounds derived from a medicinal herb alleviates insulin resistance and glucose intolerance in obese mice. Endocrinology. 2009;150:625-633.
50. Hoo RL, Wong JY, Qiao C, Xu A, Xu H, Lam KSL. The effective fraction isolated from Radix Astragali alleviates glucose intolerance, insulin resistance and hypertriglyceridemia in db/db diabetic mice through its anti-inflammatory activity. Nutr Metab. 2010;7:67.
51. Long Y, Zhang XX, Chen T, Gao Y, Tian HM. Radix Astragali Improves Dysregulated Triglyceride Metabolism and Attenuates Macrophage Infiltration in Adipose Tissue in High-Fat Diet-Induced Obese Male Rats through Activating mTORC1-PPAR γ Signaling Pathway. PPAR Res. 2014;2014:189085.